EST 1182624 is a singleton


Sequence

>1182624 (1 EST) Length=389 GTTTAATATGAAAAAATGANCCTTTANCANGAAANGCCTTTCTGAANTTTCTTCATAAANGCCTTAANGGCTCACACATT AATTACCTCACANGCAGATTGACTTTTAAACAGAAAGACATTTAGGTGGATATTTTAAGTTCCCAACTCAGCGAACTGAT AATGGTGACCGTCTCCTGCAGCTGTGCTCAGACAATCGTTTTTAGTAAGCACTAATTTTAGGCATGAGGGGAGACATCGT ATAACATGGCGAACTGTCATATGATTTTACAACCTCAAGTGGTGTCCGTCAAGGCTGTACACTATCCCCATTTTTGTTTA ACTTCATTATGGACCCGCTGCTGGAAATAACACTCTCTTNGACTGAATTTTCAGGAATTGATCTACCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1182624: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826242160081L81218SCMRAP0317ENR2/ENR2 three hour schistosomula worm


Date: 4:1:56 on Sun 19 Nov 117.