EST 1182626 is a singleton


Sequence

>1182626 (1 EST) Length=240 GTGATCGACTGGATCATGAAGACGTCAACATCTGGAGAGAAGCACGGGATACAATGGACAGCTAGGATGCAACTGGATGG TTTAGACTTCGCAGATGATCTGGCTCTTATTATCACACACGCAAAANCNAATNCAGNAGACGACCAGTGTAGAAGCAGCC CCANCAAGCAGTAGGTCTCAATACACACCAAGGGANANAGCAAGACTCTCCGATACAATANAGCANATCACCAATCATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826262160083L81220SCMRAP0319ENR2/ENR2 three hour schistosomula worm


Date: 0:25:57 on Thu 23 Nov 117.