EST 1182629 is a singleton


Sequence

>1182629 (1 EST) Length=183 GTTATAACAAAATGAATGATTTCCCCAGTATTTTGGANTACTTGAGCTGCGAATTGTTGAGAGACACCAACCAAACTATG GCCATCTACTTGAACAATTACGATCGTACACTTGAATACGACCATCAGCCTCTGCAGCACCTCCAGAAGTAAGTGATTTA ATGAATATGCTTAATTTCTGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1182629: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826292160086L81223SCMRAP0322ENR2/ENR2 three hour schistosomula worm


Date: 2:1:34 on Sat 18 Nov 117.