EST 1182630 is a singleton


Sequence

>1182630 (1 EST) Length=339 GTATCTTAATTTTAATATCAATATCCTTGATAGTTTGACTCCATGTGTAACTATCTCTAATGGCTCCGTTGTAGCAATCG GGATCTGCCTGATAGACTTTTAATTCATCATTCTCTTCACTTTTGGATGTTAAGTTTTTAACGCTTGATGGACACCCAGA TACATTTTTATCCTCGTTTGAAGGTAAGACAGTGATATTTGGCTGCTTTGGTTCTTCTTTGATGACTGATTCTACAATTT TGACTGATTGGTTGGTGTCTACCTGACGATGACGCTGGTAACCCTCAAATATTGTCTTATATTTCTCGTAAGCCATAAGA ATCATTTCGATGCTCACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1182630: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826302160087L81224SCMRAP0323ENR2/ENR2 three hour schistosomula worm


Date: 6:7:34 on Fri 24 Nov 117.