EST 1182633 is a singleton


Sequence

>1182633 (1 EST) Length=275 GTCCCAGGAACGGTTTTGGAATAGGTGGGTTCCAGGGTTCAAATGGTTCGGCACTCCCTAGGTTAGCTGGGATATGGTGG CTTTCGTTNGGATTTTCCTGGGACCTTNCTTNGTTNGCACGGTGAATACTGGCTCCTCANGTTTCAAGGTCCCGTGGGCC TATGGGTTTTGGTCCCCATTTACAGGGACGGCGGGTCTTTTTGGCATTAGGTACTTTTAAACTCCTGGANGGCGNCGTCC ATTTGGTGGTGTGCANCGAGTCTCATTACAGCGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826332160090L81227SCMRAP0326ENR2/ENR2 three hour schistosomula worm


Date: 22:29:20 on Tue 21 Nov 117.