EST 1182636 is a singleton


Sequence

>1182636 (1 EST) Length=174 GTGGAGGTACAATGTTTCGAGGTTTCCCTGAACGACTACGTAAAGAATTGCATCATCTAGCCCCAAAAGGTGCTACAGTA AAGGTGATGGCATCTCCTGAACGAAAATACTCGGTTAATGGATTGGTGGTGCTGTTCTAGCCTCTTTAAGTACTTTCAAT GAAATGTGGGTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1182636: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826362160093L81230SCMRAP0330ENR2/ENR2 three hour schistosomula worm


Date: 2:58:37 on Mon 20 Nov 117.