EST 1182638 is a singleton


Sequence

>1182638 (1 EST) Length=494 GTAAAGATAATAATGAAAGACTTGATGCTGCGGCTCGATATAGAGTACGTGATGCAAGTGTATCTATTGGATTTAATAGT TGAATAGGACGAAAATTATCACCCATTCTAGTTNGTAGTTTTTCATTGGAACCATAAGGTAAATTACGAAATAAATTAAT CTGTTCACGTGTAATTAACACTGGGATCTATAAAAACAGTCCAAAGAACATTTTCTGTGCATGGTGGAGTTGTTAGTGAA CCAAAATAGCGAAAATAACGACTAGGATTCAACAAGCTTAGAAGTAGCGCTAAATTTATATCATCAATTGTCGAATTATT TGGAGGGACGAATTGCGAATTCAGTACACCAGAAAAATTGTTATATGCCTTGAACGCTGTTTGTTCATATTTTANTGATT CAACAATTTGATGCATGATACCAAGAACAGCAAGTCCACCTGGTCGACCAATAGCTTCACCAGGTGAAGAAGTTNCCTTA GGAGGGTACCNAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1182638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826382160095L81232SCMRAP0332ENR2/ENR2 three hour schistosomula worm


Date: 20:53:19 on Wed 22 Nov 117.