EST 1182640 is a singleton


Sequence

>1182640 (1 EST) Length=329 GTTTTGGCTATGGAAAATAAACATGAGCCGCAAGCAATTGCTTATCTTCGTATTCTTGATGTTGGTGGTCAAGGTAAACT GACTTCACTAACATTGCGGTATTTCTACGACGGNNATTNGAAGACAAACTACGTGCTTCAGATAATGATACACCAAGTTT TGACAATGTATTAAATGAAATCTTTGATATGGTACGACCAGCGAATCCCCATTACATCACCTTAGATGACCTTATCAATT GTGGTAAGGGTGACACGGTAATAAACATATTAATCGATCTCCAGGTTTTTGGGCCCATGAGAATCGTGAAGCTTTTACTT CCGAAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1182640: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826402160097L81234SCMRAP0334ENR2/ENR2 three hour schistosomula worm


Date: 1:28:45 on Sun 19 Nov 117.