EST 1182643 is a singleton


Sequence

>1182643 (1 EST) Length=566 CGAATTACTTGTCATCTGACTACTGACTTTCCATCGAATAATCACGAGTGGAATTCATTACCTCAGCACGTGGTGAGGCT CCATCCGTCGACTCCTTCAAAAGAAAGTTGGATCAGCTGAGAGACCATCATTGCCAGGACTAGCACAGGCCATCAAGCCT CCCTTTTCTTTTCCAAACTGATACTGAATCCATAACAATATAAATGAATCAAAGTTGAAAGAGAATCTATTGCATAGTTA CTAATTAAGTTACCTTTATNGATTTTTCTTTTCCTTTTTCTTTTTTTGTGGATTCCTTAGATATCTGCTTTATTTCATAT ATATGGAGTGATATTATACTTATTAATTAAAAATATGGTAAATTGATATATCATCTATTAATGATACATATTAACATCGG AACAATGAACTTATGGCACATCCAATTTCTTCAACATTAAAAGGAAATTATTTCTGTCCCNAAAGGGGTTTTGTGAGTTT TAGTANTTTANATAGTAAGATCATAGTCGTCGNTCTAAAAAGCAAGGCTACGACCNCGNATTCGTAATCATGGTCATGTG NTCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1182643: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826432160100L81237SCMRAP0356C2/S1 day seven schistosomula mini-library


Date: 4:30:0 on Mon 20 Nov 117.