EST 1182644 is a singleton


Sequence

>1182644 (1 EST) Length=180 GAACCGAACGATGGGGTTGGATAATTATGCAACTGGTTCAGGANACATATTGAACTAAAATTGTGGTGTGTAAAGACNAT GTTATAACTAGGTATACTAGCACCACTTTGAGTGGGGACAATTGAATTCGGATCTGGAAATTGTGTGGCATAAACCCTAT TGTCTCTTGGTAGGTAACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182644: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826442160101L81238SCMRAP0357C2/S1 day seven schistosomula mini-library


Date: 2:19:55 on Wed 22 Nov 117.