EST 1182646 is a singleton


Sequence

>1182646 (1 EST) Length=387 CGGTAAGGGGTTGAGTATCCCTCTCGTGGCGGACTCGAAACCCCACGTGCCCTTTTTGCGTTTAAAACACTTACTCNGCG GTTGGTCCACCTATGCTACTGAGTCCAGATAGCCACTTGTGATATAAGGCAATCCGCACAGGTTGTACATATATCAATAA TAGACTGATCAGTTGCAGTCCTAAACATCAGTGAGACGATTCAAACAAACTCATGAACTATATTATTCGTCCAATCTTCC GAAATTCTTAACAGATATATGTTTATCTAAAACAATCGTTGATTGATCTTATTGGTAGATCAAGAAATAGTTGTGTTTTT AATTNCAAGCAGTATTTCATACATCATTTAGAAAATGTTCAATATCAACTAATACATATGTAACCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1182646: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826462160103L81240SCMRAP0359C2/S1 day seven schistosomula mini-library


Date: 2:36:0 on Thu 23 Nov 117.