EST 1182649 is a singleton


Sequence

>1182649 (1 EST) Length=260 CGAAAGTCGGAACTTGATGTTGTGGCTACAACTCTTCCGTTAGATGTAGATGACGAGGAATACATTGAATCATTTATTGA ACTCAAGTTAATCGGCGGTGAACACGAAGTAAACTCCTCAGATGACCGAATTAGATCTTTGTAAATGGAAGTCCCATCAG AAGCTGTTAAGGTTTTTGTTGTATCTAGGTGGTAGCAAATTCAATGGAGAAAACTGATTAACATGATCACAACAACAGAT ATTTCTTAATAAAGACGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182649: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826492160106L81243SCMRAP0362C2/S1 day seven schistosomula mini-library


Date: 18:27:40 on Sat 18 Nov 117.