EST 1182655 is a singleton


Sequence

>1182655 (1 EST) Length=780 AGACGACGACGGTCATCAATTTCACACTAGATANCNGTGTCCTCAAATTGTAAANGGAAGTACAGGACGATTACGTAAAC GTATGGCAAGTATGCGTGACATCGGAATGTGAGCGGTCTCCGAATTAACAGGAAAATGTCCTCAAGAATCAATTCNAAGT GCCCTTATTTTTGTATGTGGAATTACAATCCTCCCAGTAAGAATGCAGATNATAAGAAACACGGAATTCTAAACGAAGAA ATCGAAACAAGAATCCTAATAATCAGTCTACAAATCCAGTATCNGAAAGAATTGTCAAAGAATGGTTAATTTGAAGCATG AACACGAATCTCCGTGAAAAAGGAACAGTGAACACGTTGGAGTTAATGCTTTACGTAAATCNTTAAATGGAAATAAAGAT TCNAACTCCCAGAAAATCCNATCCAGTGAAACACAAAACGTCATGTTGGCGATGTGGTAAGTGTCATTCNGCCAATGTTT GCTATTTAAAAAACGAGTATGCTTTCAATGTGGTAAATATGGTCATGCTCAAGTATGTTGTAAAAGTAGGCCGAGGTTTC TGACCGTGAGCATAAGTCCCGTAACGAAATAAGATGCAGACTTCAAAATCAATACCGCATAACTCAAATGTTGTTCTGGC TACAAAAGTGAGCATTTCTTCNCTAAAAGGAAGTATGTACCATCNTTTTCGATGGCAACCGGTCAAANTACAAGTCGATA CTGGGTCTGACANAACATTAATTTCCAGAGAACTTGGATAAAATTGGTCGACCCCGTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826552160112L81249SCMRAP0369C2/S1 day seven schistosomula mini-library


Date: 22:34:45 on Tue 21 Nov 117.