EST 1182658 is a singleton


Sequence

>1182658 (1 EST) Length=409 CGAGAACCGACGGATTGTATTGTCTTTGTTGAATCTCGGAGTTTTACGTGATTGTCAATTATGTGAAGAAGTTCCTCTGG TTGAGGGATACGATTTGTGTACAATTTCGACCAGACTGGGATATCTGAAAATCAAATCAAAATAATCGGAATTTCAGTAG GAGGAAAGGGATTTGATTACGTGTTTAGATAGAATGCTTTTAGCCCCTCAAATACATGTAAAANGTGACTCATTGTGAAT AATTGACACTTCTCAATGCTAAGAATTAGTATGACAATGTCTCAACATGTTGAAGGTTTTTTTAAATGAATAACAACGAT TCATGTCAAAAAAAAAGTGAAATTAACTAGAATTCAAGTATTTAATTTGTGATACGGGAATTTCAGNGTTATTATTNCCA AAACGCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1182658: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826582160115L81252SCMRAP0372C2/S1 day seven schistosomula mini-library


Date: 23:25:27 on Fri 17 Nov 117.