EST 1182660 is a singleton


Sequence

>1182660 (1 EST) Length=218 CGGACAGCCTTGTCTGACTCCAGTCCTTACTGGAAATGCAGCTGTCAGTTGTCCTCCATTCACCACTTTGCACTGTAGTC CATCGTATGAGTTCTGGATCATGTTGACAATCTTCTGAGGGATTCCATAGTATAGAAGGGTATATATGTATCTACTCAAA CTCAAACTCTATTATTTAACTTTGCGCTTTGCCTTGCTGCACCCTTATAAANTTTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1182660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826602160117L81254SCMRAP0374C2/S1 day seven schistosomula mini-library


Date: 6:44:43 on Tue 21 Nov 117.