EST 1182662 is a singleton


Sequence

>1182662 (1 EST) Length=244 TAAGACAACGGAAAAGTCAGATTCGAACTGGCGTCCGCGGTCTGTAGTGATTGTGGAAGGGCAGCCGAAATTTGCTACCC ATCGTTCGACGAAAGCGCGGGCCACGGTTTCAGCAGTAATGTCCTTAATCAGTACTGCTTCTGGCCATCGAGTGAAACGG TCTACGGATGTTAGGAGATATGAGTATCCGTTTGAGTCGGGTAATGGTCCTAGCAAATCTAGATGAACGTGGTTGAAACG AGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1182662: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826622160119L81256SCMRAP0376C2/S1 day seven schistosomula mini-library


Date: 14:30:39 on Sun 19 Nov 117.