EST 1182666 is a singleton


Sequence

>1182666 (1 EST) Length=352 CGTATGACCTTCGGTCTCACTAGTGAACACAGCCTCTATACCACAGTCGAGATCTAACAGTGTTCGTCTTACTTCACGAT ATTGCGTAATCGTCATACTTTGCCTGCAGTGAATTCTGGCTTTGTGGTCTAGAGGTTAAGGGTTCGTGTGCGAGACTGAA GATCCTGTATTTAATCCTGTGTTGGAGTCTTGAATGTTCACTGTGGGGGGAGTACCGTACTAAGAAAAAAACGACCATCC AGTGCTTCCAGCTCTTCAGTGGTGGTCTAGTTAAGATCAGTTCGTGATTTAAACTATGAATATAAGCATTTGGTTCATTT CACAAAGAGTTTACTCGGTTACTCCTTATTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182666: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826662160123L81260SCMRAP0381C2/S1 day seven schistosomula mini-library


Date: 11:35:57 on Wed 22 Nov 117.