EST 1188738 is a singleton


Sequence

>1188738 (1 EST) Length=496 TGGCAGATTTAATACCAGCATCACCCATGCCTACAGTATTGTTATCGGTAGCAAGCACATCACCTTGAATGCCACCGGAG GCGGCTTTTTGACCGCCTCCAAACAATTTAGACATGGCGCCACCAGCAAGAGCAGAAGCAATACCGCCAGCAATAGCACC AAACATAAATCACCTCACTTAAGTGGCTGGAGACAAATAATCTCTTTAATAACCTGATTCAGCGAAACCAATCCGCGGCA TTTAGTAGCGGTAAAGTTAGACCAAACCATGAAACCAACATAAACATTATTGCCCGGCGTACGGGGAAGGACGTCNATAG TCACACAGTCCTTGACGGTATAATAACCACCATCATGGCGACCATTCAAAGGATAAACATCATAGGCAGTCGGGAGGGTA GTCGGAACCGAAAAAAACTCAAAGCGAACCAAACAGGCAAAAAATTTAGGGTCGGCATCAAAAGCAATATCAGCACCAAC AGAAACAACCTGATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1188738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11887382289602AA542690MB4SLY2B07T3Brugia malayi L4 JHU93SL-BmL4


Date: 16:14:50 on Sun 19 Nov 117.