EST 1188756 is a singleton


Sequence

>1188756 (1 EST) Length=464 AAAGGCGACCAGAGTATCTCGGGAACGCTGCGCCCACTACTCAACGATAGGCCAATGCCGCTCACAACAACGACATCTGC CCGCCCGGCGGACAGAAGGCTGAACAGTCGAGATCGAAACCCTCGCGACGGTTGAGCCCCAGACGCTTGAGCGCCTTGGC AAAACGCTGGGCCAGCAGATCGGCGAAGGGCCCTTCACCGCGCATGCGGGCGCCAAAACGGCTGTCGTATAGCTCACCGC CACGGCTCTGGCGGATCAGGCTGAGCACATGGGCCGCCCTTTGCGGGTAATGCGCCGCCAGCCACTCCTCGAACAGCGGC GCCACTTCCAGGGGCAGGCGCATCATCATGTAGGCCGCGCTCTGCGCCCCCGCGGCATGGGCCTCGCTGAGCAGGCTTTC CANCTCGCTGTCGTTGATCATCGGAATCATCGGCGAACACAGCACGCCCACCGGGATGCCCGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1188756: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11887562289620AA542708MB4SLY2D02T3Brugia malayi L4 JHU93SL-BmL4


Date: 13:27:34 on Fri 24 Nov 117.