EST 1188780 is a singleton


Sequence

>1188780 (1 EST) Length=430 TACCATTTTATTATATTTGGTACAGAATTATTGCTTGAATTGCTTCTAATAGCTTCAAGTAAATGGAAATATGCAGGTAT CATTGGAGGATACTGACACTACTGAAGTTATTGACCGGTGTGATTTATCGAAATCTTTTCGAGAAGACTCAAGATAAGAA ACCTGCGATGAAGATGGGAAAGAAGCAGAAGAGCAACATGTGGATTTTATTGGTGCTGAAGATTTCACCGAAAAAGATTT TGAAGCTTTAAAACAATATGGTGTTTATCCATCATATGTCGAAGTGATCCAATGTGATAAGGATCCAGAGCTAAGGGCGA TAATGGATTCCCTACAGAAGACCACCAGTGAGAAAGTGGATGAAGTGGTTGATTCCGATGGATCGGATTCTGAAATCGAT TTCTTATTGAGAAGTGGTACCGTATTACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1188780: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11887802289644AA542732MB4SLY2F07T3Brugia malayi L4 JHU93SL-BmL4


Date: 21:45:49 on Sat 18 Nov 117.