EST 1188791 is a singleton


Sequence

>1188791 (1 EST) Length=358 GTATTGCTTCAACCGAGCATATCAATGTCCTTCTACAAACTGTGATTTACCAATGATGGAACATTCCCGAAGAATGGTTC ATAGGAATGTTTGCGTGGAAATAACAACGCAGAATTATGTACACTTAAGTGGTGACTTCAGCAGCGCAGTGGTGGATGAA AGAAATGCACAAGAGAAATACAAATATGACAAAAGCGATGTCATTCATGTTGGAAGCAACTCCTTAACAATGAGCCATCA TCAGTGACAACCGATCGATATATATCATTTAGCTGCATATTACACCACAATTGGTTATATTAGTTTCGATTTAACTGAAA TTAATTGCTATTCAGAGTGAGTGAATGAATATTCTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1188791: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11887912289655AA542743MB4SLY2G10T3Brugia malayi L4 JHU93SL-BmL4


Date: 23:9:6 on Mon 20 Nov 117.