EST 1188795 is a singleton


Sequence

>1188795 (1 EST) Length=359 TTTTACTGATGACATTCGAACAAAGCCTACCACAGGTCGCTGGTCAATGTTGCCTAGGATAGAATGTGCAGTCATCATTA TCATCGTTCTTCCCATTTTTCTCAGATTACTCATGGTTGTTACCACAACCTTCATTTTCCGGCGTTATTCATCCCGATCA AAAAGAAAGCGAAGGATGTTAGGTTGAAGCGGATGGTATGCTGGGGGTCTAATATTGATACATGTAATCGAAATTTTAAA GTTCTTACGAATGATAACTCATAGTAATGCTAAAACGAATGATAACTCATAGTAATGTTTGACATGATTAAACTATTGTT TCATTTTAATTTAAAACAGTAATAAACTACTCTTGCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1188795: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11887952289659AA542747MB4SLY2H03T3Brugia malayi L4 JHU93SL-BmL4


Date: 13:33:5 on Thu 23 Nov 117.