EST 1188807 is a singleton


Sequence

>1188807 (1 EST) Length=427 CAGTTTGCATCGATGTCTAAAATCAGAATGGAAAATCGGTCATATCGATATTCGGTGTATGGAAATAAACGGAGAAGATT GGAACCTGTCAGGCAACAAATAGTTTCTACTATTACATCGAAGAAAAAAAAAAAAGCCTCAACTCTGGTTTTTTCGGTTT TATCTCAAGATTTGTTGCACCAGTGACAAATCTTTTTCGACCATCAGTTAAGTCACATGCAAGTGAGAAAACATGCACTT CAAATTCTGATGCTACTTGTTCTGGACGTTTGAGTAAGGGACCAATAAATGGCACTGCGCATCAACTCAACAAGAAAGGA ACTAATGAATTAATGACTGGTGACGACGACGACCCAGTAATTATCGAAGAAGACGATTCTATTTTGTATTCATTGATTTC AAAAAAGATTTATATTCTGGTGGAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1188807: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11888072289671AA542759MBL2SK3A09T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 9:45:44 on Fri 24 Nov 117.