EST 1188842 is a singleton


Sequence

>1188842 (1 EST) Length=102 TATGTGGACCGTTGGATTTCATGTCTTCGTCTAAATATAATGCAGAATGTTGTGCCGAGCAATTTGCTTTAACTATAAGA AAGCCTTCCAAATAATATACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1188842: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11888422289706AA542794MBL2SK3G02T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 20:53:8 on Wed 22 Nov 117.