EST 1188847 is a singleton


Sequence

>1188847 (1 EST) Length=389 GACAGACATGGAGGAGGATCCCTATGCTGTAAGCTCGGATACTGATACTGAATCATTGAAGGGTCCACCGCCAAAAATCA GCATTGAAGGGCGATCTGTTGCTGATATTTCTTCACTTAAAGCCGCTTTAAGGGAAACAAAAGAGGCGCTGAAGGATGAA AAACGTCTCGAGCGTTTTTTTTTTTTTTTTTTTTCCAAACGAAAAATATTTTAGAATTTGAGTGAAGGACTATCCCTCTC TATGCAGAATAACGAAAGCACCAAGAGCAATCAAAACCGCATATTTCAATTTGGGATAATCATTCATTAGTATTGTGACC ATCCCAACATAAGGTACGAATCCCTTTGCTCTACCAACAACATCTCTTCGTGTCAGCCAAAACTGTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1188847: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11888472289711AA542799MBL2SK3H01T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 19:58:40 on Sat 18 Nov 117.