EST 1191868 is a singleton


Sequence

>1191868 (1 EST) Length=777 GCACGACGNAGCACCACTGGATGCTATCATTTCGCACATAGAATATGGCGCTGAAGAGATATGAAGTGGTGAACGAATTG TGGATGGAGATTAACAGAAAATATGCGTTGGCCGGTTGGGTGGTGCTGTATTATACAACGATGCTAAAGCGATGTAACTT AGCTTCCTTGTTGGGACTTCCGGAAATAAGCGGATACAGTTTACTTTTGCAAATTGCATAAGCGTTATTATCCAAAAATA GAAGCAATGACATGTATTATCATCATTATTTACTGAAATGGGACAAATTGAAATATTGTCACAGGGAGATGTAGAGTTAT CTTGATGCTGAGAAAACGCTAACGCGAATGTGTATTGTGGAACATCGCGATGAAGCAGAGAAGAATGTCAATTCAATGTT TATTGTGTGTCAAAAATATCTTGTTGATTGAAGAACGATTGCACAAGTTTACAAGAAACAAAAATTCAAACNAGTCGAGA GAAAGTAATTGAATTGGCAAAATATGCAATGGTTAATGATGAGCTGATCAATGAATTGAGTATTTGGGAAATGCCAACAT TTCCAATTGGTGGGATTGACTTGATGCCTAACAATATTTCACCTGGGACCACATGTTAAGCCAATCCTTGACTATCCTTT TCCCAATATGGATTGAAAGTGAATGGGATGAATAAGTTAAAGAAGAATTGTTAAAGCTTATCCATGATATTGAAATGGAC TGATAAGAAAAACCGCGTTTGGATGTAACGAAAGCTTACTCTGGAACGCCTAATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1191868: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11918682307110AA545819SWMFCA2312SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:32:11 on Sun 19 Nov 117.