EST 1191883 is a singleton


Sequence

>1191883 (1 EST) Length=643 ATTCACGCTAACGTTACGTACTTTACGCCAAAACAATGGGTATTACAGGAAAATTGAAGGATTTGAGAATAACACCAAGT TTGACTAGAATGATTGACAGAATCGTATCGCATGACGATATCTTCTATCGTTCAGAGCAACGTGATACACCCGACTTAAC GATGCAGGAAAAAAGAGAATTGTTGGAAAATTTATATGCGACAAATTCACACTTATTCATGAGACGTTATCACAAATATC TGGCAGTGGAAGATTGCGAGTGTTTTGATCAAAATGATTACGAAATTCAGTTTTATGCAAAAGCAGTTATGGAAAGATGT AACGATAGGGATATCAAGAAGCGGGAGAATATAAGACTTCGAAATCAGCGCTATGCAGAATTAATGCGATTAAAAAGAGA AACTGATTATTTTTCGGATAAGAAAATGCGAGAACGCGAACCACTACTGTTTGATAAAATGATTGGTAGATTTTTGCCAG AAGAGGAACAACTCTATCTTAGACCAACTATTGAAAATGATCTCTTTCTGGTGTTTTTATGCCATTTGAAGATCCCAGAT CATTTCAAATCGACGAAATGCTCCTTTAAATGAATGGAATGACTTTTTAAAGTATGATAGGGAGAATGTTCGAAATTTGG TGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1191883: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11918832307125AA545834SWMFCA2337SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:21:8 on Sat 25 Nov 117.