EST 1191885 is a singleton


Sequence

>1191885 (1 EST) Length=484 CTTGGGCGACTAAAGCTGTTGTGAACAGAGCAGAGGAAATACAGTAGAGAAAATTGATTTGGAGTAAACCAGAGGAAAAG AAGGAGTGGAAGAGTATTACAGTTTCTTCACTCATTACTCTGCGACCGTCTACTACTTCTACATGGAACTCTATTCTGGC CGCAAGTTCATCAGATAGCAAGCAGTTGGATAAGTTCAAACGTTTAATGGGCATGAAAAAAAGTGATGAAGAAGGTCTAG AGGAAGTGCCANAAGTGGATGATAATCAGGTTGANGCTGAAAGAAGACGACAGNNTGAACTTTACNGTCATTTAGATCAT CTGTATGCTGTAGCACGATCTTTTACTCATCTCAGTCGAGGTCAGGGACTTGGCTTCCATCAGTGANTTACTTTGGTCTG ATCNNATGCTGTAGTTATGAATTATTCATCTGTTGCTTCACAAAATCTCGTGCGAAATGCTGAAGGAATGTAGAAGTTTG GATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1191885: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11918852307127AA545836SWMFCA2347SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 5:57:14 on Thu 23 Nov 117.