EST 1191920 is a singleton


Sequence

>1191920 (1 EST) Length=878 ATCTGTCGGCGGTTATATGCTTGTCTCAAAGGCTAAGCCATGCATGTCTAANTTCAAATAAACCTATAATGGTGAAACCG CGAACGGCTCATTATAACAGCTATAATGTACTTGATGTTGATTATCCAACGTGGATAACTGTGGCAATTCTAGAGCTAAT ACATGCACCAAAGCTCCGAATTTTAAACGAGCGCATCTATTAGATTAAAACCAATCGGATTATTAATTTTAATCCGTTAA TTGGTGACTCTGAATAGCTATGGCTGATCGCATGGTCTTGTACCGGCGACGTATCTATCAAGTGTCTGCCTTATCAACTT TCGATGGTAGTTTATGTGCCTACCATGGTTGTAACGGGTAACGGAGAATAAGGGTTCGACTCCGGAGAGGGAGCCTGAGA AACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCTCAGAATGAGGAGGTAGTGACGAAAAATAAC GAGACCGTTCTCTTTGAAGCCGGTTATCGGAATGGGTACATCTGTCAAAACGTAACGCAGGTGTCCTAAGGCTAGCTCAG AAAAGACGGAAACCTCTCGTAGAGTAAAAGGGCAAAAGCTCGCTTGATCTTGATTTCCAGTACGAATACGAACCGCGAAA GCCGTTGGCCTATCAATCCTTTTGAATTTTTTAAGAAGGTTGGTATGCAAATTACATCTGAGACTTACCGGGTATACGGC CCAACAATGAAACGTTGATAAACCGTGGTCCACTGAATTTCGGAGAAGGTGCAAAAACTTATGCCGGANAGGAAAGANAA GGCCCGGTTAATCAATGTTGTTCCAACTGGTTTATTCCAAATTCCTGGGCAAAGGCCTCTGNCCAAACCACCTGTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1191920: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919202307162AA545871SWMFCA2419SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:17:7 on Wed 22 Nov 117.