EST 1191922 is a singleton


Sequence

>1191922 (1 EST) Length=151 GAAATGTGCCATTTTTAACATTGTCCCTAGTCTTTTCGATGATTTTCTCATTCTAATTTTTTATTTAAAAGCTTCTGTAC CACATGTAGATTTTACGATTCGTAGTCCCTTGTTTCTCTTGTATACTGCAAATAGTATAAAAAGTTTTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1191922: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919222307164AA545873SWMFCA2421SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:30:36 on Fri 17 Nov 117.