EST 1191923 is a singleton


Sequence

>1191923 (1 EST) Length=763 CGACTGTCTNATTAAAACAGAGGAGACAGATGGCCCTTGCGGGCGTTGACTGTCTCTGATTTCTGCCCAGTGCTCTGAAT GTAAAAGTGAAGAAATTCAACCAAACGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCNT CATCTAATTCGTGACGCGCATGAATGGATTANCGAGATTCCCACTGTCCCTATCTACTATCTAGCGAAACCACAGCCAAG GGAACGGGCTTGGCAAACACAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCCGACTCTGTGAAGAGTCATGAG AGGTGTAGCATAAGTGGGAGGTTTTTTTTGTATTTATTATACAAATACCAACAGTGAAATACCACTACTTTCATCGATTC TTTACTTATTCGGTAAAACGAGAATTGAAATATTATATGTTATTTCGAAATTTTTGATTTAAGTTAAATCACTCGGTGAT TTAACGACTCGCACCCGAAAGACAGTGTCAGGCGGGGAGTTTGACTGGGGCGGTACATCTGTCAGGCAGGTTATTCGTCG TGATAAGGCCCGCAAAATAACTGAGGAAGAAGAAGCCAATTCAAAGTGTACTGTCATTTACGTCAACTCCGCGCCGACAA ACGTCTAAAAAGGTGCTCGTGATAAGAAGGCTCGTGAAATTACCGGAAGAAGGTGTTGGTGGTGGTAAACAATAAATATT TCTGAAGGACACATTTGGGTTGTATTTTGGAATTGTTTTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1191923: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919232307165AA545874SWMFCA2422SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:49:50 on Sat 18 Nov 117.