EST 1191930 is a singleton


Sequence

>1191930 (1 EST) Length=273 GGATGATGAGGAGAAACACAGGTGGAAAAGGAGGGGACTATGCTCCAGCTCCAGAGAAGGATAGCACCCAGAGCTCTGAT GTGTCTCTCTCAGCATGAAGACAGCTGCCTGAGTGGACAGTGGCAAACGATGTTTTCAGGTCCCTCCTGTGACATCCAGA GTCCTCAGTTCCCTTTAGTCAATGGCATCTTAAGTTCCCTGTGATCCTGTCAGCTCCATGCTGCCCTGAGCTGCAGCTCT CACTTCCCCACTGAAAATAAAAATGCAAATGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1191930: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919302307172AA545881SWMFCA2430SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:6:55 on Tue 21 Nov 117.