EST 1191939 is a singleton


Sequence

>1191939 (1 EST) Length=663 AGATTCTGTTTGTTACATTTGGTCTTCAATGGCACCTCTTGATTTGTGCAAGCTAGCACCATGGGCACNGTATCAGTTTC TTCGTAAAATTTCCATCTTCAATCGCGATTGTTTAGAGGAAAATAACATCAAAGCGGCGCAGTTATTCCGGCTTACGCCG GGATATGTCAATGATGAAGCGGATCTACGAATGCGAGCAAAATTTCTTCGTGCAAATGTAGAAGGACAGGATTGTATTTT AGCTCCAGCAGGTGCCCAACAGTGCCTTTCTTGCTTTCAAAAGATTGATCGAGGTTTAAAGAAAGTGGATAAAGCGTACG AAAACTTTAACCTTACGTTACACCGATTTGATTGTATGTTGGCTGTAGATACTGCTAGCGCAACAAGGCCTTTTTCACCC AATGGCTCCTGTTACTGATTGCAAGATTTGGTACAGGAAATGGTTAGTGGTAAATTTATTGAATTTTGTGGTCCGTTCCG CCAAGTTATAAATTGGTGCTACCTATGTTCCAATTAGCCTTGTTCCTCCATCNTTGCTACCAANTTAAAGTGGTTGAATA CGCGGGTCCTCCCNAGTTTCCCGTTGTNTAAGAATCTACACCATACCAACNNTTTGGTGTTCCTCCAAGANCCCTGAATC TAAGTTGAAATTCAACAAACTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1191939: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919392307181AA545890SWMFCA2440SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:26:48 on Fri 17 Nov 117.