EST 1191940 is a singleton


Sequence

>1191940 (1 EST) Length=423 CATCTTAGGNCCACTTTTTCAATAGGTTTCAAAGCTCCTTCTAGGAGGTGNGACAACNAGATGATCTATNGTCCTTGTTT TAGGTGTTANTTNAATTTTTGCAGGGTTCATTGCCATGGGAGGAANATTANGGATTAANATGAANTGGGTCAAATGAAAG AGGAAATGAATTTAAATGTTTTATTGGATGGTTGTCCAAGAGAATTACATGATTTTGCAGCATATCTAGNAACACTTGGC TATCCAGATGAGCCAAGTTNTGGCTTATTGGAAAATAATCTACGAAATATTATTACNCGGCATGGTTATTATTACCGATG AGCCATATGAATCGGGAAAATTAATTATGAAAAATCTTGGTCCAAAAATTCCGCCTAAATNGTACCAATCCCCTGCNCCG AAATCCTTTCCCATTTCAACCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1191940: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919402307182AA545891SWMFCA2441SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:46:19 on Thu 23 Nov 117.