EST 1191954 is a singleton


Sequence

>1191954 (1 EST) Length=774 ACATTAAGAAAATTGGCTACAACCCTGACACAGTAGCATTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGTTGGAG CCAAGTGCTAATATGCCTTGGTTCAAGGGATGGAAAGTCACCGCAAAGATGCAGCGCCAGTGGCACCACACTGCTGGAAC TTTGGATTGTATCCTGCCACCAACTCGTCCAACTGACAAACCCCTGCGCTGCCCTCCAGATTCTATAAAATTGGTGGTAT TGGTACTGTCCTGTGGGCCGTGTGGAACTGGTGTCTCAAACCTGGCATGGTGGTTACCTTTGCTCCAGTCATGTCCAACA GAAGTCAAGTCTGTTGAAATGCACATGAAGCCCTGAGTGAACTCTTCCTGGGGACATGTGGCTTCAATGTAAGAATGTGT CGTTAAGACGTAGACGTGGCAACGTTGCTGGTGACGCAAAATGACCACAATGGAACTGCTGCTCACTGCCAGTGATATCT GAACATCAGCAATATGCTGGCTATGCTCTGTATGGATGTCACACTGCTCACATAGCATGCAAGTTTGCTGAACTTAAAGA AAAGATGATCTCGTTCAGCAAGAGCTGGAAGATGCCTAAATCTTGAATCTGCAAGCACCATGTGAATGTCCTGGCAGCCA GTGTGTGAGACTCTCTGACTATCTCACTTGGTCGCTTGCGGTCTGACTAGCAACATTCTGTGGTGTCNCANGNTGTGACA AAAGCGCTGGACTGGCAATCACAATCGCCNAAAGCCCAAGGCAATGATATACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1191954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919542307196AA545905SWMFCA2463SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 5:7:41 on Tue 21 Nov 117.