EST 1191956 is a singleton


Sequence

>1191956 (1 EST) Length=776 AATGAATCCAACGAGTTCATNTCCGAAGTTATCAGTCGAAGAACTAGGATTAAACAAGAAGTGCAAAGAAGGAAGAGCTG ACAGTGATTCTTATCAGCAGAATGATCAATATTGACGCGATTTATTCTATCATATGGTGAACTTCACGAGAAACAGCTTC ACTTACTTCGACATCCAAAGACGGGCAGTGCAACACTGTATGCAATTGGAAATGAAAGAGTAGAAGATTGTTGAAGTTGA TGACGGTTTCAGGTCAGTTCTGCTTGGCAATAATGTGGTTAGTAATGGCTCATTAATTTTATTGGTACCAGTGAGCCCGT ACTGCTATTGCTACCTTATTGCGAAATTGCGAAGATATTACGTATCACTAAAGGAATTTAGTGGATGATATTTCCATCAA TAAAATTGCTTGAGAATGTTAAAGCTGTAAGTCATCGTTGAAGCATGCTTGTCATTGTAAGAGATATCAAGTATTGAAAC ATACAAATACAGTGAATCCTTGCTGATGGATATATAATGAACAAGATAAAGTTGTTGAAAAATCTGATCATTATATCTTA GATCAGATCCGATGTGCTGTTCGAGTATTTGGAGAGAACTCCGCTAATATACTGAGTGGTAGAATCCACGANGAATGAGA TGCGCATCGATAACGCCGAAAACGCATGCAGGAGGGAGAAATACGGAATGATCTTGCAGCATGATCACACATGAATGCNT CAACTCTCGCTGAATATATATCTAATGACTATCATGACNCGTGCTTCTATGACGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1191956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11919562307198AA545907SWMFCA2466SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:5:40 on Sat 18 Nov 117.