EST 1193853 is a singleton


Sequence

>1193853 (1 EST) Length=405 TCCACTAATAAAATGGGAACACGACCATCTCGCTGCTACAGATACTGCAGAAGCAGACCATACATCAAGTCTAGATACTG CCGTGGTGTTCCAGATGCCAAGATCAGAATCTTTGACTTAGGAAGAAAGAAGGCCCCAGTTGATGACTTCCCTATGTGTG TCCACCTTGTCTCCCTCGAAAGAGAACAACTCTCTTCTGAATCCATCGAAGCCGCTCGTATCTGTGCTAACAAGTACATC GTCAAGACTGCCGGTAAAGACGCTTTCCACATGAGAGTTAGAGTTCATCCATATCATGTCTTGCGTATCTACAAGATGCT TTCATGTGCCGGAGCCGATAGACTTCAAACTGGTATGAGAGGTGCCTTTGGAAAGCCTACTGGTCTCGCCGCTAGAGTCG CCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1193853: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11938532315005AA547804MB3D6V1B03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 8:46:48 on Mon 20 Nov 117.