EST 1193881 is a singleton


Sequence

>1193881 (1 EST) Length=293 AATAGATGGAAGTACGGACACCTATCATCCATTTAACGACTTTTGGGTTCATGATAAATTGAAAGAACTTGTCGATCCGG GCCTTAAATTCTGCATTGCATATATTTCAAAGATAAATTTTATCATCGTTAGATAATGATAATTATCATATCATTCACCA AATTTCAAATTATTACAAACAGCCGATGGTAGTGGTAAAGGTGCAGCACTAATCACAGCAATTGTTGCACGATTGAAAAA ACGAAATTTAAAACAACAACTACTAGAACAATGCAAAATTGATGAGCATATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1193881: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11938812315033AA547832MB3D6V1E12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 20:46:21 on Sun 19 Nov 117.