EST 1193901 is a singleton


Sequence

>1193901 (1 EST) Length=373 GCAAAACGCAGAGGATTTTGGTACGACTANCACTCACCAATCTACTACCGAAGATACTTCACTTACTATGACGACTATCC ACGCTATATTTATACTCCGTTTCGCACCAGAAACTATGCACCAGAAATTACTACACTCTACGGTCACTACTACTGAAAAG CGAAGCTCATTTCTCAATAAACGTGTGATACAATTAATCAGTGCCTATCGAAAACAGTTTTCCGTCCATTTTCACAAGAA AGAAATTTTTTAATCACCAACCTGTTGCATCTGAACATATACTTTACTTCATTTAGTGCCTATGCTTCATACGTAACCTC GAATACGTGGTTCACTCTACTAAACTCATGTGATACATTAAACTGTTTCCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1193901: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939012315053AA547852MB3D6V1H04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 8:41:36 on Mon 20 Nov 117.