EST 1193911 is a singleton


Sequence

>1193911 (1 EST) Length=185 CTTTATGGGGGAAAAGCTCGCGGCGAGTATTACTGTCGAGAACCACGACCTGCGCACGACCGTTCAGCTGCTCCTGATTA AAGGTGTTTCCTTCACTGAAGGTCATGCCATAGACATTAAAATAATCGCCGCTCACGCCATTGGCACTGGCAGCAACATC AACATTGTTATAACGCAGGCGCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1193911: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939112315063AA547862MB3D6V2A06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 11:15:44 on Sun 19 Nov 117.