EST 1193914 is a singleton


Sequence

>1193914 (1 EST) Length=252 AATTCGACCTAATTTCAGTTCTCATTTCAATGAAAACTCCAAGAATAAATTTTGTACCTCAAGTTCAGCAGAGCATTTTG TGACTGGTGACGGTGGCAATCGTATTTCCACAGGATCATCATGAATCTGCGGACTATCATTTCCTTCCGCTGATTTTGGT GTCAAACTATCAAGATTCTGGTCGATATGTTGTCTTTCCTATAAAATGCATAGAAAAGAATTACCAGAACTTATAAATAA ACTACCTGTAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1193914: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939142315066AA547865MB3D6V2A10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 10:45:46 on Tue 21 Nov 117.