EST 1193931 is a singleton


Sequence

>1193931 (1 EST) Length=225 CACAGTGAGGAACACAAGAAAGCGCCTGAAGAAAAAGAACCAAGGAGGACAAAGATCAAGATCAGGTCATGAAACTACTG TTTTGAAGTTTCAAATGTTGTGCAGCATGATGTTAGCAAGCTAATTCTCTGCTGAAAAATGTGCAGTTATACGTAAACCT CGAAACTAGTGTGGAAAACTGTACCAAATATCTTTCAGAAGTTTAATGAATAAAAGTTTCATGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1193931: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939312315083AA547882MB3D6V2C08T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 6:3:35 on Sun 19 Nov 117.