EST 1193932 is a singleton


Sequence

>1193932 (1 EST) Length=464 GCTTCTATTCCTCTGCTTACAGAAGAAGAAACCGATCCATATAAAATTCCAATCAAACACAATATAATGATGGCCTTATT TTGGCTAGTACAAGGTTGTCAACCTGGGGACTCTTTAGTGTTTCACTATTCTGGTCATGGTTCTCAACAAAGGAGCTATG AAGAGGCATATGGATTTGATGAAACTCTATGCCCACTAGATTTTGAAACACAAGGAATGATTGTTGACGATGATATCAAT GTAGCTATTGTCCGACCACTTCCTCGTGGAGTTAAGCTCCATGCATTTATAGATGCTTGCCATAGTGGTACTGTACTTGA TCTACCTTTTCTCTGCAGAATGAATAGGAATGGGCAATATGTCTGGGAAGATCATCGCCCAAGAAATGGCGCTTGGAAAG GTTCAAATGGTGGGGAAGTAATTTCATTTAGTGGCTGTGACGATAATCAAACATCTGCCGACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1193932: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939322315084AA547883MB3D6V2C09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 13:33:23 on Fri 24 Nov 117.