EST 1193956 is a singleton


Sequence

>1193956 (1 EST) Length=368 CACGAGGAAACTTCAGGGTGCCACCGAAAAATCGGTCGACTATTGGCTTCTTAAGAATAGTTGGAGTAAACGTTGGGGAA TCGGTGGATATCTCAAATTAGCTCGAAATAAGGAAAATATGTGCGGAATAGGATATTATGCCTGTTATCCATTAGTACCA TCTGATATTAATTAATCAGCAAATTTAATTATGATAAATTGATGTGTGCTTTATATTCCATATAAAATAAGGCATTGCAC TATTTCTTTTTTTTTGGTCTTTTCTAAAGTAAGGTATTAAATTTGAAAATTTTTGGAATTTTATTCTTTTGTAACTTTTT GAAAAAACAATTTGTTTGGAAAATATTTAAAAATAAAAAAAGCTTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1193956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939562315108AA547907MB3D6V2F04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 22:4:19 on Sat 18 Nov 117.