EST 1193960 is a singleton


Sequence

>1193960 (1 EST) Length=365 CAAATTATAGGGTATGCTTCCCCTAATTAAAACTTCAAAGTTAGATTATGGGAGTGGAGGCAATTTAATTTAGTATTGAT AATTCATGTATTTATTTTATGGTAAATATATAAGGGAATTTGGTATTTTTTTTCAAGGATCTATTGACATATATTATGCA AATTGGGTTCCATCTTTGGATTCACATTTATGTTTAGGTAGTGTGGATATTTCATTAAATAAATAGAATACTATGACTTA ATTGCAAGTAACTCCTAAATATAATTTAGCCTTGCTGATATTTAGCCATATCTGGTTTTCTTGATAGTTATGTTTACTAT CGTTTGAATGATAATATCATGCTATACATTTTGTTTTGGTTTAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1193960: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939602315112AA547911MB3D6V2F10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 18:55:22 on Sat 18 Nov 117.