EST 1193971 is a singleton


Sequence

>1193971 (1 EST) Length=251 TTTCCCTCACGGTACTAGTTCACCCTCGGTCAATGAAGAGTATTTAGCCTTGGAGGATGGTCCCCCCATATTCAGACAGG ATTTCTCGTGTCCCGCCCTACTTGTCGTTAGCTCAGTACCACACAGGTCATTTCACGTACGGGGCTATCACCCGCTATGG CCAGCCTTTCCAAGCTGTTCCGTTATGTCTTGTGCTATCACTAACAGGCTTCTCCGATTTCGCTCGCCACTACTTTCGGA ATCTCGGTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1193971: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939712315123AA547922MB3D6V2G12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 0:28:58 on Sat 25 Nov 117.