EST 1193976 is a singleton


Sequence

>1193976 (1 EST) Length=196 CTTTTCTTTCGCTTACGAACGTAGGCATGATGATCTTTACCAGCATTTCATCTTTATGGCGACATGTATATTTGCTTGTG AAACCAGAGGGCAGTGTCATCGTTTTCTTCTAAATATGCGATTTTTATTCACCGTATCGTGTGCATTCGATCATTCGACT TCTTTCAATTTTATATAATTTGTTTCTTTCAGTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1193976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939762315128AA547927MB3D6V2H05T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 8:48:30 on Fri 24 Nov 117.