EST 1199855 is a singleton


Sequence

>1199855 (1 EST) Length=500 TAAATATATATATATATATATATATATATACATATACACATCTTTATCTTTATCTTTATGTTTCTCTTTCTCTTTCATTT TAAACGAACCTGAATTACATTTACATTGTTTAAATAAGGACTTAAGACGGCACATAGACCTTAACAAAATTGCAAAAGTA AAATATAAGTTTTCTATTCTTTCTGGATATAGACCTATTTTTTCTTTAAAAAAAGTCACACTATAATCATAATTTAGATT TTTAAAATAATCATTATTAAATTTATTATTTATCTGGATTTCACCAAATAGAAAATCGTTCTTTAAATAAAAATATTCTG ATGACAAAACAGCAATATTGGATTGCATTCCAGAAATTATTTTATAGAAACTGTTCATTTCTTCACATTCACTTTTTTCA TTCTGAAAACAATTTTCTTTGTAAATCATATTCCTTTAAAGGGGTCAAAAAAAAAAAAAAAAATAAATAAATAAATAAAA AAATCAAGCTTATCGATACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1199855: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998552320097AA5498450918m3gmbPfHB3.1, G. Roman Reddy


Date: 2:56:11 on Tue 21 Nov 117.