EST 1199859 is a singleton


Sequence

>1199859 (1 EST) Length=494 AGGTACTAAAAAAATTAATAAGTATATATAAATTTGACGCCTTTATATAGTGAGCAATAAAATGACAAAAATTTATATAG GCACACAAATAAATTAATACATATATTATACATGTACACATTTATACATATCGTTGTGCCATTTAAAAAATGTACAAGAA AATGTTCATCACAATTGTTGCATGTTCATTTTTTTTTTTATTATTTATTTTTTTTTTTTTTTTTTTTTATTTTTTTTTTT TTTNCATAAGAAGCACACAAAAAATGATAGAGAATATAAATAATTATTAATATATATATTAAAATAAATTCTCCAAGTAG CACTAGACTTTATTCTTTATATATCCATTAACATTTTATGCGTCTTTTTTCCTATTCCAAACTTTAGACTCTTTACCAAA GTTAAAATATTGCTCTCTTGTTATAACATTATGGTTATATATACTTGGATCACTTAACCATNCATATGTTCCAATATAAT TACTATATAAACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1199859: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998592320101AA5498490922m7gmbPfHB3.1, G. Roman Reddy


Date: 14:35:15 on Fri 17 Nov 117.