EST 1199869 is a singleton


Sequence

>1199869 (1 EST) Length=521 TGTATTATATACAACATTTGAATAAAGGCTGAATGTAGAATTAAAATACTGTATAATTTTTTTTACGAAAGAAATGCTTA TGACAGTACTCCTAAATTATCACATTAAAAAATTATGTATATATATATGTAATGGACCGGTATTTTCGTTTTACTTATCT ATGTGATGACATTTTACTCTCTGTAAGTATATATTTTTATAATTGTACTATGGAGGGAGAAAAGCAACGTGTTAATTAAT TTTACCTTAGGCCTCATAATCTCACGATTATGACGTTACATAGTACTAGACATTGTATACGTTCGCAATTTTTTTATTGA GTTCGTATTCATGTTTAAGAGGTAGCATAATAAATGGTTAGAGGTTTTTAGACTTATAAGAGTCGAAATATAAAAATCCC TGCTTATGGGAAAGAGAAGCAGGGTTTATGCTTGCACATATGTACGTTTGGTATATATGTGGCTCGGCACTCTCTGAGGG TTTTATATATTTTTTTAATATAAAATGGTTTCACGCTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1199869: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998692320111AA5498590932m3gmbPfHB3.1, G. Roman Reddy


Date: 17:16:32 on Fri 24 Nov 117.